00       00
  
Bug Report
Report an error
  

Populus tremuloides gene model Potrs000326g37319.1
Page views 1


Locus: Potrs000326g37319 
Transcript name:  Potrs000326g37319.1 
Chromosome: Potrs000326 
Start position:  4022 
End position:  4528 
Description:  uncharacterized protein LOC105128878 
Best BLAST Aspen Potra195134g31538.1 Potri.002G021200.1  
Best BLAST ATG AT1G30750.1  
Other transcripts at this locus:  
Map Detail Image: 

 


Legend:      5'UTR          CDS          3'UTR               


Genomic Sequence (- strand)        upstream:    downstream:   
>Potrs000326:4022-4528[507 nucleotides] 
ATGGGGGTCTCCAAGTCACGCAAATATTGTATTCTTCTCTACGTTTTTCTCATCTTCCTCGTTTCTTTTATTTGCAACGCACAAGCTTTATCAACAGTTGCAGATCAGCATGTCCTAGACGTGCCACCAAATGATGAAAATACACCGGCTCGTGCTTCCCCTCCGGTTGCTGCTCCTATTCTAAACAACGCGCCTCCTTTTCGAAAACCATTAAGCAACCGAGGGCAACAGTCTCCACCGGGTTACCAGCAGCAACAAGAGCTGAATAATCCACCGCAAGACATTAATCAGCCTCGGTCAGGCCTTACTCCACCACTTTCTTCTCTGAACCAGCCCCTCTCAGGCACTAGTGTGCCCTTTTCTGCTTTGAATCAGCCTTTTGGGGCCAGTGGTTCCCAAAACTTACTGAGAAACCTTCCTTTTGCCAGTGGAGTTTCTGTGGAGAAAACCTCTACTGATCTGGGAGTCGTTTTATTTCCCCTCGTTACATTGATGGCTACGCTCTAG
   


CDS sequence:
>Potrs000326g37319.1[507 nucleotides] 
ATGGGGGTCTCCAAGTCACGCAAATATTGTATTCTTCTCTACGTTTTTCTCATCTTCCTCGTTTCTTTTATTTGCAACGCACAAGCTTTATCAACAGTTGCAGATCAGCATGTCCTAGACGTGCCACCAAATGATGAAAATACACCGGCTCGTGCTTCCCCTCCGGTTGCTGCTCCTATTCTAAACAACGCGCCTCCTTTTCGAAAACCATTAAGCAACCGAGGGCAACAGTCTCCACCGGGTTACCAGCAGCAACAAGAGCTGAATAATCCACCGCAAGACATTAATCAGCCTCGGTCAGGCCTTACTCCACCACTTTCTTCTCTGAACCAGCCCCTCTCAGGCACTAGTGTGCCCTTTTCTGCTTTGAATCAGCCTTTTGGGGCCAGTGGTTCCCAAAACTTACTGAGAAACCTTCCTTTTGCCAGTGGAGTTTCTGTGGAGAAAACCTCTACTGATCTGGGAGTCGTTTTATTTCCCCTCGTTACATTGATGGCTACGCTCTAG
   

Transcript sequence:
>Potrs000326g37319.1[507 nucleotides] 
ATGGGGGTCTCCAAGTCACGCAAATATTGTATTCTTCTCTACGTTTTTCTCATCTTCCTCGTTTCTTTTATTTGCAACGCACAAGCTTTATCAACAGTTGCAGATCAGCATGTCCTAGACGTGCCACCAAATGATGAAAATACACCGGCTCGTGCTTCCCCTCCGGTTGCTGCTCCTATTCTAAACAACGCGCCTCCTTTTCGAAAACCATTAAGCAACCGAGGGCAACAGTCTCCACCGGGTTACCAGCAGCAACAAGAGCTGAATAATCCACCGCAAGACATTAATCAGCCTCGGTCAGGCCTTACTCCACCACTTTCTTCTCTGAACCAGCCCCTCTCAGGCACTAGTGTGCCCTTTTCTGCTTTGAATCAGCCTTTTGGGGCCAGTGGTTCCCAAAACTTACTGAGAAACCTTCCTTTTGCCAGTGGAGTTTCTGTGGAGAAAACCTCTACTGATCTGGGAGTCGTTTTATTTCCCCTCGTTACATTGATGGCTACGCTCTAG
   

Protein sequence:
>Potrs000326g37319.1[168 residues] 
MGVSKSRKYCILLYVFLIFLVSFICNAQALSTVADQHVLDVPPNDENTPARASPPVAAPILNNAPPFRKPLSNRGQQSPPGYQQQQELNNPPQDINQPRSGLTPPLSSLNQPLSGTSVPFSALNQPFGASGSQNLLRNLPFASGVSVEKTSTDLGVVLFPLVTLMATL
   



GO ID Description
Loading data from server


PFAM ID
Loading data from server


PANTHER ID
Loading data from server


KO ID
Loading data from server


EC ID
Loading data from server


KOG ID
Loading data from server



Login | Site Map | © 2021 PlantGenIE.org.| All our tools are under MIT License


  • GeneList
      view active genelist () here.
      genelist namegenesrenamedelete
      add empty genelist / save current list / cancel
  • Analysis
  • <