00       00
  
Bug Report
Report an error
  

Populus trichocarpa gene Potri.002G021200
Page views 1


Locus: Potri.002G021200 
Transcript name:  Potri.002G021200.1 
Protein name:  27020943_peptide 
PAC Transcript ID : 27020943 
Chromosome: Chr02 
Start position:  1282486 
End position:  1283253 
Synonyms:  fgenesh4_pg.C_LG_II000202;POPTR_0002s02280; 
Description:   
Best BLAST Aspen Potrs000326g37319.1  
Best BLAST ATG  
Other transcripts at this locus:  
Map Detail Image: 

 


Legend:      5'UTR          CDS          3'UTR               


Genomic Sequence (- strand)        upstream:    downstream:   
>Chr02:1282486-1283253[768 nucleotides] 
ATGGGGGTCTCCAAGTCACGCAAATATTGTATTCTTCTCTATGTTTTTCTCATCTTCCTCGTTTCTTTTATTTGCAACGCACAAGCTTTATCAACAGTTGCAGATCAACATGTCCTAGACGTGCCACCAAATGATGAAAATACACCGGCTCGTGCTTCTCCTCCGGTTGCTGCTCCTATTCTAAACAACGTGCCTCCTTTTGGAAAACCATTAAGCAACCAAGGGCAACAGTCTCCACTGGGTTACCGGCAGCAACAAGAGCTGAATAATCCACCGCAAGACATTAATCAGCCTCGGTCAAGCCTTACTCAACCACTTTCTTCTCTGAACCAGCCCCTCTCAGGCACTAGTGTGCCCTTTTCTGCTTTGAATCAGCCTTTCGGGGCCAGTGATTCCCAAAACTTACTGAGAAACCTTCCTTTTGCCAGTGGAGTTTCTGTGGAGAAAACCTCTACTGATCTGGGAGTCGTTTTATTTCCCCTCATTACATTGATGGCTACGCTCTAGTTTGCCAGTATAGCCGATTTAGGACCATCATCAGCCAATCTGCCTTCCAATCTTCCATCCCCTTCTCGGCGGTCGGCAACTTCCATGTTACCTTTTATTTTTTTAAGTGATCGTGTTCGTGTTCATGTTCATGTTCATGTGAGGATGGTTCCACACCACACCAGTGTGGAGAAACATCTGAAACCTGTACCTTAATATGATGATTTGAACATATTAAAATATGTTCTCTTCATCTATGTTTTATAGATGTTATTTGTATTT
   

CDS sequence:
>Potri.002G021200.1[507 nucleotides] 
ATGGGGGTCTCCAAGTCACGCAAATATTGTATTCTTCTCTATGTTTTTCTCATCTTCCTCGTTTCTTTTATTTGCAACGCACAAGCTTTATCAACAGTTGCAGATCAACATGTCCTAGACGTGCCACCAAATGATGAAAATACACCGGCTCGTGCTTCTCCTCCGGTTGCTGCTCCTATTCTAAACAACGTGCCTCCTTTTGGAAAACCATTAAGCAACCAAGGGCAACAGTCTCCACTGGGTTACCGGCAGCAACAAGAGCTGAATAATCCACCGCAAGACATTAATCAGCCTCGGTCAAGCCTTACTCAACCACTTTCTTCTCTGAACCAGCCCCTCTCAGGCACTAGTGTGCCCTTTTCTGCTTTGAATCAGCCTTTCGGGGCCAGTGATTCCCAAAACTTACTGAGAAACCTTCCTTTTGCCAGTGGAGTTTCTGTGGAGAAAACCTCTACTGATCTGGGAGTCGTTTTATTTCCCCTCATTACATTGATGGCTACGCTCTAG
   

Transcript sequence:
>Potri.002G021200.1[768 nucleotides] 
ATGGGGGTCTCCAAGTCACGCAAATATTGTATTCTTCTCTATGTTTTTCTCATCTTCCTCGTTTCTTTTATTTGCAACGCACAAGCTTTATCAACAGTTGCAGATCAACATGTCCTAGACGTGCCACCAAATGATGAAAATACACCGGCTCGTGCTTCTCCTCCGGTTGCTGCTCCTATTCTAAACAACGTGCCTCCTTTTGGAAAACCATTAAGCAACCAAGGGCAACAGTCTCCACTGGGTTACCGGCAGCAACAAGAGCTGAATAATCCACCGCAAGACATTAATCAGCCTCGGTCAAGCCTTACTCAACCACTTTCTTCTCTGAACCAGCCCCTCTCAGGCACTAGTGTGCCCTTTTCTGCTTTGAATCAGCCTTTCGGGGCCAGTGATTCCCAAAACTTACTGAGAAACCTTCCTTTTGCCAGTGGAGTTTCTGTGGAGAAAACCTCTACTGATCTGGGAGTCGTTTTATTTCCCCTCATTACATTGATGGCTACGCTCTAGTTTGCCAGTATAGCCGATTTAGGACCATCATCAGCCAATCTGCCTTCCAATCTTCCATCCCCTTCTCGGCGGTCGGCAACTTCCATGTTACCTTTTATTTTTTTAAGTGATCGTGTTCGTGTTCATGTTCATGTTCATGTGAGGATGGTTCCACACCACACCAGTGTGGAGAAACATCTGAAACCTGTACCTTAATATGATGATTTGAACATATTAAAATATGTTCTCTTCATCTATGTTTTATAGATGTTATTTGTATTT
   

Protein sequence:
>Potri.002G021200.1[168 residues] 
MGVSKSRKYCILLYVFLIFLVSFICNAQALSTVADQHVLDVPPNDENTPARASPPVAAPILNNVPPFGKPLSNQGQQSPLGYRQQQELNNPPQDINQPRSSLTQPLSSLNQPLSGTSVPFSALNQPFGASDSQNLLRNLPFASGVSVEKTSTDLGVVLFPLITLMATL
   



GO ID Description
Loading data from server


PFAM ID
Loading data from server


PANTHER ID
Loading data from server


KO ID
Loading data from server


EC ID
Loading data from server


KOG ID
Loading data from server



PlantGenIE GeneLists

Species Name Genes
Amborella trichopodascaffold00041.152;
Picea abiesMA_36566g0010; MA_142765g0010; MA_156299g0030; MA_26909g0010; MA_5831221g0010; MA_156299g0010; MA_25658g0010; MA_9418976g0010; MA_1056310g0010; MA_142765g0020; MA_156299g0020;
Pinus taedaPITA_000010564-RA; PITA_000031311-RA; PITA_000009014-RA; PITA_000095178-RA; PITA_000065039-RA; PITA_000050620-RA; PITA_000050619-RA; PITA_000050621-RA; PITA_000095433-RA;
Populus trichocarpaPotri.002G021200;
Vitis viniferaVV18G10710;


Methods of the gene family analysis can be found here.

No submitted publication available for this gene(Potri.002G021200).


Map Image: 
Login | Site Map | © 2021 PlantGenIE.org.| All our tools are under MIT License


  • GeneList
      view active genelist () here.
      genelist namegenesrenamedelete
      add empty genelist / save current list / cancel
  • Analysis
  • <